
1403787-62-1
- Product Name:Bepirovirsen
- Molecular Formula:C230H290N88O115P19S19
- Purity:99%
- Molecular Weight:7344.00
Product Details:
CasNo: 1403787-62-1
Molecular Formula: C230H290N88O115P19S19
Appearance: White to off-white Solid
Delivery Time: 2 weeks after order
Packing: Bottle
Throughput: 1KG/Month
Purity: 99%
Description |
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1]. |
||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
In Vitro |
Bepirovirsen (16-250 nM; 16 h) reduces hepatitis B virus (HBV) RNA, DNA, and viral proteins in HepG2.2.15 cells[1]. MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only. Bepirovirsen Related Antibodies |
||||||||||||||||||||
In Vivo |
Bepirovirsen (22-50 mg/kg/week; s.c. twice weekly for week 1 and once weekly for weeks 2-4) reduces hepatic HBV RNA and DNA in HBV-transgenic mice[1]. MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.
|
||||||||||||||||||||
Clinical Trial |
|
||||||||||||||||||||
Molecular Weight |
7344.00 |
||||||||||||||||||||
CAS No. | |||||||||||||||||||||
Appearance |
Solid |
||||||||||||||||||||
Color |
White to off-white |
||||||||||||||||||||
Sequence |
DNA, d(P-thio)([2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]rA-G-G-T-G-A-A-G-m5C-G-A-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC) |
||||||||||||||||||||
SMILES |
[Bepirovirsen] |
||||||||||||||||||||
Shipping |
Room temperature in continental US; may vary elsewhere. |
||||||||||||||||||||
Storage |
-20°C, sealed storage, away from moisture *In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture) |
||||||||||||||||||||
Solvent & Solubility |
In Vitro: H2O : ≥ 20 mg/mL (2.72 mM) *"≥" means soluble, but saturation unknown. Preparing
View the Complete Stock Solution Preparation Table * Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles. * Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.
Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol) In Vivo Dissolution Calculator Please enter the basic information of animal experiments: Dosage mg/kgAnimal weight Dosing volume Number of animals Recommended: Prepare an additional quantity of animals to account for potential losses during experiments.
|
||||||||||||||||||||
Purity & Documentation |
Purity: 98.44% Data Sheet (273 KB)SDS (252 KB) Handling Instructions (2659 KB) |
||||||||||||||||||||
References |
|
Complete Stock Solution Preparation Table
* Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles.
Storage method and period of stock solution: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). When stored at -80°C, please use it within 6 months. When stored at -20°C, please use it within 1 month.
Optional Solvent | ConcentrationSolventMass | 1 mg | 5 mg | 10 mg | 25 mg |
---|
H2O | 1 mM | 0.1362 mL | 0.6808 mL | 1.3617 mL | 3.4041 mL |
* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.
Relevant Products
-
Amifostine
CAS:20537-88-6
-
Octafluorohexanediamiddioxime
CAS:7170-05-0
-
SINENSETIN
CAS:2306-27-6