2563929-84-8
- Product Name：Bepirovirsen sodium
- Molecular Formula：C230H290N88Na19O115P19S19
- Purity：99%+
- Molecular Weight：7762.00
Product Details:
CasNo： 2563929-84-8
Molecular Formula： C230H290N88Na19O115P19S19
Appearance： White to off-white Solid
Packing： Bottle
Throughput： 1KG/Month
Purity： 99%+
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC)
Bepirovirsen sodium (16-250 nM, 96 hours) can reduce the levels of HBV RNA transcripts in HBV-expressing HepG cells.
Bepirovirsen sodium (22 and 50 mg/kg, administered subcutaneously, twice a week in the first week and once a week from the second to the fourth week) can reduce hepatic RNA transcription in HBV transgenic mice, followed by a decrease in HBV DNA production and related HBV serum antigens.
Relevant Products
-
Inclisiran sodiumCAS：1639324-58-5
-
Methyl N-Boc-4-ethylpiperidine-4-carboxylateCAS：578021-55-3
-
NitisoneCAS：104206-65-7
